What is the Genetic Code and How Does it Work?

PsychologyFor Editorial Team Reviewed by PsychologyFor Editorial Team Editorial Review Reviewed by PsychologyFor Team Editorial Review

What is the genetic code?

No matter how much morphological diversity living beings present, we are all united under the same umbrella: our basic functional unit is the cell. If a living being has one cell on which its entire morphological structure is based, it is known as unicellular (the case of protozoa or bacteria), while those of us who have several (a few hundred to hundreds of billions) are multicellular beings.

Thus, every organism starts from the cell and, therefore, some molecular entities such as viruses are not considered strictly “living” from a biological point of view. In turn, studies have characterized that each cell contains a whopping 42 million protein molecules. Therefore, it is not surprising that it is estimated that 50% of the dry weight of living tissues is composed solely of proteins.

Why do we provide all this seemingly unconnected data? Today we come to unravel the secret of life: the genetic code As mysterious as it may be at first glance, we assure you that you will understand this concept immediately. It’s all about cells, proteins and DNA. Stay to find out.

    What is the genetic code?

    We start clearly and concisely: the genetic code is nothing more than the set of instructions that tell the cell how to make a specific protein We have already said in previous lines that proteins are the essential structural unit of living tissues, which is why we are not dealing with an anecdotal question: without proteins there is no life, it’s that simple.

    The characteristics of the genetic code were established in 1961 by Francis Crick, Sydney Brenner and other collaborating molecular biologists. This term is based on a series of premises, but first we must clarify certain terms to understand them. Go for it:

      The bases of the genetic code

      Once we are clear about these basic terms, it is time for us to explore the main characteristics of the genetic code, established by Crick and his colleagues These are the following:

        Unraveling the genetic code

        We already have the terminological bases and the theoretical pillars. Now it’s time to put them into practice. First of all, we will tell you that Each nucleotide receives a name based on a letter, which is conditioned by the nitrogenous base that it presents The nitrogenous bases are the following: adenine (A), cytosine (C), guanine (G), thymine (T) and uracil (U). Adenine, cytosine, and guanine are universal, while thymine is unique to DNA and uracil is unique to RNA. If you see this, what do you think it means?:

        CCT

        CCU

        It is time to recover the terms described above. CCT is part of a DNA chain, that is, 3 different nucleotides: one with the base cytosine, another with the base cytosine and another with the base thymine. In the second case of letters in bold we are dealing with a codon, since it is the genetic information of DNA “translated” (hence there is a uracil where there was previously a thymine) into a chain of RNA.

        Thus, we can affirm that CCU It is a codon that codes for the amino acid proline. As we have said before, the genetic code is degenerate. Thus, the amino acid proline is also encoded by other codons with different nucleotides: CCC, CCA, CCG. So, the amino acid proline is encoded by a total of 4 codons or triplets.

        It should be noted that it is not that all 4 codons are needed to encode the amino acid, but that any of them will do. In general, Essential amino acids are encoded by 2,3,4 or 6 different codons, except methionine and tryptophan that only respond to one each.

          Why so much complexity?

          Let’s do the math. If each codon were encoded by only one nucleotide, only 4 different amino acids could be formed. This would make protein synthesis an impossible process, since in general each protein is composed of about 100-300 amino acids. There are only 20 amino acids included in the genetic code but these can be arranged in different ways along the “assembly line” to give rise to the different proteins present in our tissues.

          On the other hand, if each codon were made up of two nucleotides, the total number of possible “diplets” would be 16. We are still far from the goal. Now, if each codon were made up of three nucleotides (as is the case), the number of possible permutations would increase to 64. Taking into account that there are 20 essential amino acids, with 64 codons to encode each of them and, on top of that, offer different variations in each case.

          An applied look

          We are running out of space, but it is truly complex to concentrate so much information in a few lines. Follow us in the following scheme, because we promise that closing this entire terminological conglomerate is much simpler than it seems:

          CCT (DNA) → CCU (RNA) → Proline (ribosome)

          This small diagram tells us the following: Cellular DNA contains the 3 CCT nucleotides, but it cannot “express” genetic information, since it is isolated from the cellular machinery in its nucleus Therefore, the enzyme RNA polymerase is responsible for TRANSCRIBING (a process known as transcription) DNA nucleotides into RNA nucleotides, which will form messenger RNA.

          Now we have the CCU codon in the messenger RNA, which will travel out of the nucleus through its pores to the cytosol, where the ribosomes are located. In summary, we can say that messenger RNA gives this information to the ribosome which “understands” that the amino acid proline must be added to the amino acid sequence already constructed to give rise to a specific protein.

          As we said before, a protein is made up of about 100-300 amino acids. Thus, any protein formed from the arrangement of 300 amino acids will be encoded by a total of 900 triplets (300×3) or, if you prefer, by 2,700 nucleotides (300x3x3). Now, imagine each of the letters in each of the 2,700 nucleotides, something like: AAAUCCCCGGUGAUUUAUAAGG (…) It is this arrangement, this conglomeration of letters, that is really the genetic code. Easier than it seemed at first, right?

          Summary

          If you ask any biologist interested in molecular biology about the genetic code, you will surely have a conversation for about 4-5 hours. It is truly fascinating to know that the secret of life, no matter how unreal it may seem, is locked in a specific succession of “letters.”

          So that, The genome of any living being can be mapped with these 4 letters For example, according to the human genome project, all the genetic information of our species is made up of 3 billion base pairs (nucleotides), which are found in the 23 pairs of chromosomes within the nucleus of all our cells. Of course, no matter how different living beings are, we all have a common “language.”

            Use this citation format to reference the article clearly and help readers find the original source.

            Recommended citation Updated 2024

            PsychologyFor. (2024). What is the Genetic Code and How Does it Work?. PsychologyFor. https://psychologyfor.com/what-is-the-genetic-code-and-how-does-it-work/

            Quick format for articles, references, and academic mentions.

            • This article has been reviewed by our editorial team at PsychologyFor to ensure accuracy, clarity, and adherence to evidence-based research. The content is for educational purposes only and is not a substitute for professional mental health advice.